Adrenergic Neurons Of Spontaneously Hypertensive Rats

Published Date: 02 Nov 2017

Chapter 2

2.1 Abstract

Epinephrine is synthesized by the catecholamine biosynthetic enzyme, phenylethanolamine N-methyltransferase (PNMT), primarily in chromaffin cells of the adrenal medulla and secondarily in brainstem adrenergic neurons of the medulla oblongata. Epinephrine is an important neurotransmitter/neurohoromone involved in cardiovascular regulation; however, overproduction is detrimental with negative outcomes such as cellular damage, cardiovascular dysfunction, and elevated blood pressure. Therefore, overproduction of epinephrine can lead to hypertension and cardiovascular disease. Adrenergic neurons are responsible for blood pressure regulation and are the only PNMT containing neurons in the brainstem; therefore the adrenergic neurons are linked to the pathogenesis of hypertension. Genetic mapping studies have also linked elevated expression of PNMT to hypertension. The purpose of the current study was to determine whether elevated blood pressure found in adult spontaneously hypertensive rats (SHR) is associated with altered regulation of the PNMT gene in adrenergic neurons. C1, C2, and C3 adrenergic regions of 16 week old Wistar Kyoto (WKY) and SHR rats were excised using micropunch microdissection for mRNA expression analyses. Results from the current study confirm high PNMT mRNA expression in all three adrenergic neurons (C1: 2.96-fold; C2: 2.17-fold; C3 1.20-fold) of the SHR compared to normotensive WKY rats. Furthermore, the immediate early gene transcription factor Egr-1 was elevated in the C1 (1.84-fold), C2 (8.57-fold) and C3 (2.41-fold) regions in the brainstem of the SHR. Low mRNA expression for transcription factors Sp1 and GR was observed, while no change was observed for AP-2. The findings presented propose that alterations in the PNMT gene regulation in the brainstem contribute to enhanced PNMT production and epinephrine synthesis in the SHR, a genetic model hypertension.

2.2 Introduction

Cardiovascular diseases (CVD) affect one third of the global population and is thought to be the leading cause of death (WHO, 2011). High blood pressure is a major risk factor for developing CVDs, such as coronary heart disease and heart attacks and is also the sole risk factor for developing stroke (WHO, 2011). Hypertension is more pronounced in some ethnic groups, such as African Americans, than others of European descent (Cui et al., 2003; and Kepp et al., 2007). Also, blood pressure levels are similar within families than between families, suggesting that even within a shared environment, biological siblings have similar blood pressure than adoptive siblings (Biron et al., 1976). In twin studies, monozygotic twins have similar blood pressure levels than dizygotic twins (Feinleib et al., 1977). Elevated blood pressure can also result from monogenic mutations such as a mutation in the β subunit of epithelial sodium channel causing hypertension in Liddle’s syndrome (Shimkets et al., 1994). It is estimated that approximately 30-50% of variations in blood pressure are attributable to genetics determinants (Garcia et al., 2003; and Chern and Chiang, 2004). These findings propose that hypertension has a heritable etiology and originates from a genetic basis.

The enzyme responsible for epinephrine production, phenylethanolamine N-methyltransferase (PNMT; EC 2.1.1.28), has been linked to hypertension (Axelrod, 1962). Epinephrine is synthesised mainly in the chromaffin cells of the adrenal medulla, but also in small amounts in central adrenergic neurons of the brainstem (Wurtman and Axelrod, 1965; and Saavedra et al., 1976). Basal levels of catecholamines are necessary to stimulate cardiovascular function by promoting calcium mobilization into muscle cells creating heart contractions (Minneman, 1988). Excessive levels of catecholamines are detrimental to cells of the cardiovascular system (smooth muscle cells and cardiomyocytes) by promoting cellular mechanisms that lead to excessive cellular proliferation, contractility, oxidative damage, hypoxia, and ischemia (Communal and Colucci, 2005; and Olofsson et al., 2008). These negative outcomes introduce cellular damage, arrhythmias, and cardiac dysfunction which are responsible for blood pressure elevation. Therefore, excessive catecholamines caused by increased levels of PNMT are associated with the pathogenesis of hypertension (Axelrod and Reisine, 1984; and Reja et al., 2002b). The central adrenergic neurons located within the C1, C2, and C3 brainstem regions are the only PNMT containing neurons in the brainstem and have been implicated in the pathogenesis of hypertension (Reis, 1985; and Cunningham et al., 2004). Central adrenergic neurons regulate blood pressure due to its direct link to the baroreflex. In animal models of hypertension such as the SHR, high epinephrine production and PNMT activity in adrenergic neurons are linked to elevated blood pressure (Black et al., 1981). Furthermore, studies show that when PNMT activity is inhibited in the adrenergic neuron regions, blood pressure decreases in the hypertensive rat model (Chatelain et al., 1990). These results imply that adrenergic neurons are in part involved with the development and maintenance of adulthood hypertension.

Genetic mapping studies determined that hypertension was attributed to a region on chromosome 10 in rats referred to as Bp1; however its role in blood pressure regulation remains unknown (Jacob et al., 1991; Hilbert et al., 1991; Koike et al., 1995; and Julier et al., 1997). Since one third of genetic variability in stroke-prone SHR is found in genes located in the Bp1 region, it is therefore of great interest. Koike and colleagues (1995) mapped PNMT within the Bp1 confidence interval and concluded that PNMT is therefore a good candidate gene for hypertension. Comparative genomic studies determined that the genes found on chromosome 10 in rats and chromosome 17 in humans were syntenic, where the PNMT gene found specifically at position 17q21-q22 in humans (Hoehe et al., 1992). A genome-wide QTL and linkage studies revealed linkage for hypertension on chromosome 17 in humans (Julier et al., 1997; and Baima et al., 1999). Therefore PNMT is also candidate gene in human hypertension. However, no polymorphisms were detected in the PNMT gene in SHR, compared to WKY rats, which may account for PNMT overexpression (Koike et al., 1995). The study concluded that altered transcriptional regulation may be a probable cause for high PNMT expression. In humans, genotyping studies found polymorphisms in the PNMT gene promoter region that was strongly associated with the development of hypertension in African Americans (Cui et al., 2003). However, this was not observed in white Americans, or in individuals of European descent. This suggests that the polymorphism may alter transcription of the PNMT gene in African Americans and may play an important role in the pathogenesis of hypertension in this population (Cui et al., 2003; and Kepp et al., 2007). These results demonstrate the important influence of the PNMT gene on the development of hypertension and that future studies need to examine other potential mechanisms resulting in excessive PNMT transcription such as altered transcriptional regulation.

The PNMT gene is regulated by a number of stress sensitive transcription factors that include early growth response-1 (Egr-1), activating enhancer binding protein 2 (AP-2), specificity protein 1 (Sp1), and the glucocorticoid receptor (GR) (Ross et al., 1990; Ebert et al., 1994; Ebert and Wong, 1995; Tai et al., 2001; and Tai et al., 2002). Through the hypothalamic-pituitary-adrenal (HPA) axis, corticosteroid hormones known as glucocorticoids are secreted during times of stress, and bind to their cognate receptor, the cytosolic GR, and the complex then binds to glucocorticoid response element (GRE) on the PNMT promoter (Wong et al., 1995; and Tai et al., 2002). Other studies have shown that the developmental factor AP-2 requires the presence of glucocorticoids for significant activation of the PNMT promoter (Ebert et al., 1998; and Tai et al., 2002). Neural regulation of PNMT gene expression is triggered though the sympatho-adrenal (SA) axis, where the splanchnic nerve releases acetylcholine and pituitary adenylate cyclase-activating polypeptide (PACAP) into adrenal chromaffin cells. These neurotransmitters activate transcription factors Egr-1 and Sp1 via signalling cascades such as the cyclic adenosine monophosphate/protein kinase A (cAMP/PKA), PKC and mitogen-activated protein kinase (MAPK) pathways (Wong and Tai, 2002; and Tai et al., 2007). All four transcription factors can independently activate PNMT transcription and some (Egr-1, AP-2, and GR) can synergistically amplify PNMT promoter activity beyond their individual additive outcomes (Tai et al., 2002). Recently, our laboratory has determined that elevated adrenal PNMT expression and transcription in adrenal gland tissue of SHR rats was associated with increased levels of regulators Egr-1, GR, Sp1, and AP-2, implying enhanced HPA and SA axes activity (Nguyen et al., 2009). Elevated levels of PNMT were previously found in the adrenergic neuronal regions of the SHR and therefore further studies are required to determine which transcriptional regulator is responsible for its dysregulation (Saavedra et al., 1976; Saavedra et al., 1978; and Chalmers et al., 1984).

The study of hypertension through various animal models has helped elucidate several molecular mechanisms responsible for its pathogenesis. The aims of Objective 1 of this thesis are two-fold: the first was to examine altered expression of PNMT and other catecholamine biosynthetic enzymes in the adrenergic neuronal regions, and the second was to examine expression of transcription factors responsible for PNMT regulation which may be partially responsible for hypertensive phenotype in male SHR rats.

2.3 Methodology

2.3.1 Animal Protocols and Housing

All animal protocols were approved by the Laurentian University Animal Care Committee and followed the Canadian Council on Animal Care guidelines. Six male SHR and six male Wistar Kyoto (WKY) rats were purchased from Taconic Farms (Germantown, NY, USA) at 12 weeks of age. Rats were housed in pairs within polycarbonate N40 series cage system with wire bar lids to allow free airflow (Ancare, Bellmore, NY, USA), containing soft cob bedding (Harklan, Madison, WI, USA) and enrichment accessories such as a large tube (Bio-serv, Frenchtown, NJ, USA). Food (Teklad 22/5 Rodent Diet, Harklan, Madison, WI, USA) and water were available ad libitum. Rats kept a 12 hour light-dark cycle, with the light phase being 6:00 am to 6:00 pm. The room temperature was constantly maintained at 25oC, and humidity was kept around 53%.

2.3.2 Physiological Measurements

Rats were weighed once per week. At 13 weeks of age, animals were acclimatized to a non-invasive tail-cuff plethysmograph (CODA 6, Kent Scientific, Torrington, CT, USA) (Feng et al., 2008). Blood pressure was monitored three times per week from weeks 14 to 16 of age. Animals were firstly acclimated to the CODA 6 for 10 minutes followed by 30 recorded measurements. The testing period was performed between the hours of 8:00 am and 2:00 pm, during the light cycle period.

2.3.3 Tissue Collection

At 16 weeks of age, the rats were anaesthetized by an intraperitoneal administration of 75 mg of ketamine (100 mg/mL, Ketalean, CDMV inc., Montreal, QC, CA) and 5 mg xylazine (100 mg/mL, Sigma, St. Louis, MO, USA) per kg of body weight. Animals were sacrificed and trunk blood collected in Vacutainer vials containing EDTA (BD, Franklin lakes, NJ, USA). Blood was centrifuged at 1500 x g for 20 minutes at 4oC. Aliquots of the plasma fraction were collected and stored at -80oC until further processing. Tissues were collected and immediately frozen on dry ice and stored at -80oC until further processing.

2.3.4 Tissue Cryosection

Brains were removed from the -80oC freezer and placed in the cryostat chamber (Leica CM3050 S, Leica Microsystems, Wetzlar, Germany) 30 minutes prior to sectioning to allow equilibration of the tissue to the cryostat temperature of -15oC. Brains were dissected at the pons and brainstems mounted onto the cryostat chuck with tissue embedding media (Histo PrepTM, FisherDiagnostic, Fair Lawn, NJ, USA). Collection of tissue sections started when the medial longitudinal fasciculus was macroscopically visible (Appendix B: Figure B.1) (Paxinos and Watson, 2007). The first tissue section of the brainstem was collected at a 30 μm thickness and stained with hematoxylin and eosin (H&E) for neuroanatomical topography analysis. Subsequently, the second and third tissue sections were collected at a 10 μm thickness for immunohistochemistry (IHC) and in situ hybridisation (ISH), respectively. Successively, the fourth tissue section was collected at a thickness of 300 μm for micropunch tissue excision and subsequent RNA extraction and analysis. This process was repeated until macroscopic examination of the inferior colliculus (Appendix B: Figure B.9) (Paxinos and Watson, 2007). Sections dedicated for H&E staining were maintained at room temperature and all other microscope slides containing sections were kept frozen until further processing.

2.3.5 Hematoxylin and Eosin Staining

Brainstem sections were H&E stained for neuroanatomical topography analysis to view the cellular morphology and to identify the location of the adrenergic neuron regions. H&E protocol was performed as per a modified Harris H&E protocol (Puchtler et al., 1986). In short, sections were immersed in 70% ethanol (10 minutes), washed in water (30 seconds) and stained with hematoxylin (8 minutes). Tissues were rinsed in water (5 minutes), immersed in 1% acid alcohol (30 seconds), rinsed in water (1 minute), immersed in 0.2% ammonia water (30 seconds), and rinsed once more (5 minutes). Sections were immersed in 90% ethanol (1 minute), counterstained with eosin (30 seconds), dehydrated in 90% ethanol (5 minutes), cleared in xylene (10 minutes) and mounted with xylene mounting medium (Fisher Scientific, Kalamazoo, MI, USA). Slides were left overnight to dry, and sections were observed under light microscope (Veritas Microdissection, Arcturus Bioscience Inc., Mountain View, CA, USA) for the identification of the location of the C1, C2, and C3 adrenergic neurons.

2.3.6 Micropunch Dissection

Brainstem adrenergic neurons were dissected and isolated using micropunch dissection, as per Palkovits and Brownstein (1988). An 18 gauge needle (BD and Co., Franklin Lakes, NJ, USA), with an inner diameter of 838 μm, was cut and bevelled to make a flat cutting surface and stored in 5 M NaCl until use. Needles were air-dried, protected by an autoclaved microcentrifuge tube and subsequently frozen on dry ice. A frozen cutting surface was used to keep brainstem micropunched tissues frozen. Once the adrenergic regions were micropunched, tissues were expulsed into frozen 2 mL round-bottom microcentrifuge tubes and RNA extraction was immediately performed. C1 adrenergic neuron regions were microdissected from sections with the appearance of Figure B.2 (Appendix B) until sections resembling Figure B.6. C2 adrenergic neuron regions were isolated from sections with the appearance of Figure B.3 until sections resembling Figure B.4. C3 adrenergic neuron regions were extracted from sections with the appearance of Figure B.4 until sections resembling Figure B.5.

2.3.7 RNA Extraction

Total RNA was isolated, from the C1, C2, and C3 micropunches, as per Chomczynsky and Sacchi (1987). Briefly, a stainless steel bead along with 250 μL of Solution D (4 M guanidine thyocyanate, 25 mM sodium citrate, 0.5% sodium sarcosine, 0.1 M β-mercaptoethanol) and 25 μL of 2 M sodium acetate was added per sample. Tissues were mechanically disrupted using the TissueLyser (Quiagen, Newtown, PA, USA) for two cycles of 2 minutes at a frequency of 30 Hz. To the homogenate solution, 250 μL of phenol and 50 μL of chloroform was added and mixed well. Samples were centrifuged at 4000 x g for 15 minutes at room temperature. The aqueous phase was collected into a fresh microcentrifuge tube with 1 mL of 90% ethanol and incubated for 3-4 days. Samples were then centrifuged at 12000 x g for 20 minutes at 4oC. The supernatant was discarded and 250 μL of 70% ethanol was added to each pellet and samples were re-centrifuged at 12000 x g for 20 minutes at 4oC. The supernatant was discarded and RNA pellets were air dried. The pellet was dissolved in 20 μL of DEPC treated water. Concentration of the total RNA was determined using the spectrophotometric measurement of the absorbance at 260 nm (NanoDrop ND-1000, Nanodrop Technologies, Wilmington, DE, USA).

2.3.8 Quantitative Reverse Trasncriptase Polymerase Chain Reactions

The relative gene expression of PNMT and of its transcription factors was performed using real-time reverse transcription polymerase chain reaction (qRT-PCR). A quantity of 2 μg of total RNA was treated using DNase I (Sigma-Aldrich Corp., MO, USA) following the manufacturer’s guidlines. Subsequently, samples were subjected to reverse transcription using MaximaTM Reverse Transcriptase (Fermentas, Burlington, ON, CA) as per manufacturer’s protocol. A quantity of 125 ng was subjected to qRT-PCT using GoTaq qPCR master mix (Promega, Madison, WI, USA). The 25 μL reaction contained 1x GoTaq® master mix buffer, 2 ng/µL of forward and reverse primers (Table 2.1), sample, and water. Forward and reverse primers were validated, as per Livak and Schmittgen (2001) to verify for similar amplification efficiencies. Each reaction, run in duplicate, was incubated for 2 minutes at 95oC, followed by 50 cycles of 95oC (1 minute), 58oC (1 minute), and 72oC (1 minute). A melting curve was used to analyze reaction specificity after the amplification reaction where each sample was incubated at temperatures ranging from 75oC to 95oC, with a 1oC increase every 30 seconds. The value of the threshold cycle (Ct), generated during the qRT-PCR reaction, was used for relative quantification (ΔΔCt) as per Livak and Schmittgen (2001).

Table 2.1: Primer sequences utilized and amplicon product size for qRT-PCR.

Gene

(Accession Number)

Forward Primer

Sequence (5'-3')

Reverse Primer

Sequence (5'-3')

Amplicon Size (bp)

Annealing Temperature (oC)

(Forward/Reverse)

AP-2

(XM_225238)

CCTGCCAAAGCAGTAGCAGAAT

AAGCCATGGGAGATGAGGTTGA

221

61/61

DBH

(NM_013158)

TTCCCCATGTTCAACGGACC

AGCTGTGTAGTGTAGACGGATGC

240

57/65

Egr-1

(AY551092)

TTTCCACAACAACAGGGAGAC

CTCAACAGGGCAAGCATACG

261

57/55

GR

(AY066016)

CTCTGGAGGACAGATGTACCA

GCTTACATCTGGTCTCATTCC

232

59/57

NFL-L

(NM_031783)

GAAGAAGGTGGTGAGGGTG

AACTGGTTGGTTTGGTGATG

178

55/53

PNMT

(X75333)

CATCGAGGACAAGGGAGAGTC

AGCAGCGTCGTGATATGATAC

219

61/57

Sp1

(NM_012655)

CAGACTAGCAGCAGCAATACCA

TGAAGGCCAAGTTGAGCTCCAT

224

61/61

TH

(L22651)

GCGACAGAGTCTCATCGAGGAT

AAGAGCAGGTTGAGAACAGCATT

150

63/61

2.3.9 Statistical Analyses

The data for the physiological measurements are presented as mean ± standard error of the mean (SEM). Statistical significance between both groups was determined by an unpaired t-test (GraphPad Prism, La Jolla, CA, USA). The data for the gene expression analyses are presented as mean ± standard deviation (SD). Statistical significance between groups and regions was determined by ANOVA followed by Newman-Keuls post-hoc test. Results were considered statistically significant with a value of p ≤ 0.05.

2.4 Results

2.4.1 Physiological Measurements

Systolic, mean arterial, and diastolic pressures (Figure 2.1 A) and heart rate (Figure 2.1 B) were measured in 16 week old WKY and SHR rats (Nguyen et al., 2009). Systolic blood pressure was 48 mmHg higher in SHR (188.3 ± 3.7 mmHg) compared to normotensive WKY controls (140.1 ± 6.4 mmHg) (p=0.0001). Mean arterial pressure was 35 mmHg higher in SHR (151.6 ± 4.8 mmHg) compared to WKY controls (116.9 ± 5.9 mmHg) (p=0.0005). Diastolic blood pressure was 29 mmHg higher in SHR (134.0 ± 5.5 mmHg) compared to normotensive WKY controls (105.4 ± 5.8 mmHg) (p=0.0025). Heart rate of the SHR (359.98 ± 8.4 bpm) was 32 beats per minute (bpm) higher than the WKY controls (327.9 ± 5.0 bpm) (p<0.0036). Body weight (Figure 2.1 C), was also measured in the 16 week old SHR and WKY rats. SHR (347.0 ± 9.7 g) were 128 grams (g) lighter than the WKY (475.8 ± 14.4 g) (p=0.0001).

Figure 2.1. Physiological parameters of 16 week old WKY and SHR rats. (A) Systolic, mean arterial, and diastolic pressures of WKY () and SHR () are expressed in mmHg. (B) Heart rate is expressed in beats per minute (bpm). Blood pressure and heart rate were obtained by non-invasive tail-cuff plethysmography method (CODA 6, Kent Scientific). Data are presented in expressed in mean ± SEM. (C) Body weight is expressed in grams (g). Data is displayed in a box plot as minimal and maximal weights ± SEM. Unpaired t-test: statistical significance between WKY and SHR is shown by ** p < 0.01 and *** p < 0.001.

2.4.2 Gene Expression of Enzymes Responsible for Catecholamine Biosynthesis in Adrenergic Neurons

Expression of mRNA for the catecholamine biosynthetic enzymes, TH, dopamine β-hydroxylase (DBH), and PNMT, was analysed by qRT-PCR in the adrenergic brainstem regions (C1, C2, C3; Figure 2.2 A-C). TH mRNA expression levels were significantly higher in C1 (2.75-fold; p=0.0017), C2 (1.38-fold; p=0.1306) regions, and lower in the C3 region (0.47-fold; p=0.0124) of the SHR compared to the WKY. DBH mRNA levels were low in the C1 (0.55-fold; p=0.0502) and in C3 (0.4-fold; p=0.0458), but elevated in C2 (1.73-fold; p=0.0135)regions of the SHR. PNMT mRNA expression levels were significantly higher in C1 (2.96-fold; p=0.0006), C2 (2.17-fold; p=0.0029), and C3 (1.20-fold; p=0.4138) regions in the SHR compared to the WKY.

Figure 2.2. mRNA expression of enzymes responsible for the biosynthesis of catecholamines, TH, DBH, and PNMT, of WKY and SHR rats. Fold-change comparison of (A) TH mRNA levels between WKY () and SHR (), (B) DBH, and (C) PNMT. Data is expressed as mean fold-change ± SD. Fold-changes were obtained by relative quantification (ΔΔCt) of qRT-PCR threshold cycles (Ct) as per Livak and Schmittgen (2001). ANOVA followed by Newmal-Keuls post-hoc test: statistical significance between WKY and SHR is shown by * p ≤ 0.05, ** p < 0.01, and *** p < 0.001, and statistical significance between SHR adrenergic neurons shown by † p ≤ 0.05, †† p ≤ 0.01, and ††† p ≤ 0.001.

2.4.3 PNMT Transcriptional Regulator Expression in Adrenergic Neurons

Analysis on the mRNA expression of transcriptional regulators of the PNMT gene was performed to determine possible genetic mechanisms responsible for elevated brainstem PNMT mRNA expression in the SHR (Figure 2.3 A-D). Results show that Egr-1 was significantly higher in C1 (1.84-fold; p=0.005), C2 (8.57-fold; p<0.0001) and C3 (2.41-fold; p= 0.0006) regions of the SHR, compared to WKY controls. In contrast, decreases in Sp1 (C1: 0.63-fold, p= 0.0547; C2: 0.57-fold, p= 0.0247; C3: 0.51-fold, p= 0.0054) and GR (C1: 0.58-fold, p= 0.0251; C2: 0.48-fold, p= 0.0038; C3: 0.58-fold, p= 0.0302) mRNA was observed. Furthermore, no changes were detected in transcription factor AP-2 (C1: 1.2-fold, p= 0.4256; C2: 1.17-fold, p= 0.6127; C3: 1.14-fold, p= 0.6201).

Figure 2.3. Expression of mRNA levels pertaining to the PNMT transcription factors found in adrenergic neurons of WKY and SHR rats. Fold-change comparison of (A) Egr-1 mRNA levels between WKY () and SHR (), (B) Sp1, (C) GR, and (D) AP-2. Data is expressed as mean fold-change ± SD. Fold-changes were obtained by relative quantification (ΔΔCt) of qRT-PCR threshold cycles (Ct) as per Livak and Schmittgen (2001). ANOVA followed by Newmal-Keuls post-hoc test: statistical significance between WKY and SHR is shown by * p ≤ 0.05, ** p < 0.01 and *** p < 0.001 and statistical significance between SHR adrenergic neurons shown by *** p ≤ 0.001.

2.5 Discussion

Catetcholamines, such as epinephrine, is important for blood pressure regulation and is required at basal levels to promote heart muscle contraction and other cardiovascular functions (Borkowski and Quinn, 1984). It is produced in abundance to elevate heart rate and stroke volume when coping with stress (Axelrod and Reisine, 1984; and Bühler et al., 1982). However, excessive levels of catecholamines are detrimental to cells of the cardiovascular system and induce cellular damage, arrhythmias, and cardiac dysfunction which are responsible for blood pressure elevation (Dhalla et al., 2001; and Adameova et al., 2009). Excessive catecholamine production is associated with the pathogenesis of hypertension. In animal models of hypertension, such as the SHR, show elevated levels of epinephrine, and increased PNMT expression in the adrenal glands and in central adrenergic neurons were documented in this genetic model (Axelrod and Reisine, 1984; Jablonskis and Howe, 1994; Reja et al., 2002a; Reja et al., 2002b; and Nguyen et al., 2009). Altered transcriptional regulation of the PNMT gene in adrenergic neurons was proposed as an important factor responsible for the overproduction of epinephrine and therefore is a possible genetic mechanism for the pathogenesis of hypertension.

Increased expression levels of catecholamine the biosynthetic enzymes TH, DBH, and PNMT in adrenergic neurons of SHR is supported by previous studies (Chalmers et al., 1984; Saavedra et al., 1976; Saavedra et al., 1978; Reja et al., 2002a; and Phillips et al., 2001). In the current study, TH mRNA was elevated in C1 and C2 adrenergic regions, and DBH mRNA was high in C2 adrenergic regions. Elevated PNMT mRNA expression in all three adrenergic areas of the SHR, compared to WKY rats, was observed. These data suggest that the elevations in epinephrine found in the SHR may be caused, in part, by elevated expression of the PNMT gene in the adrenergic neurons. High PNMT and TH immunoreactivity and PNMT activity were previously reported in the C1 region (Saavedra et al., 1978; and Phillips et al., 2001). When this region is removed or lesioned, blood pressure is reduced in rats (Reis et al., 1984b; and Madden and Sved, 2003). Conversely, studies also suggest that when these neurons are activated (electrically or chemically), it creates an elevation in blood pressure and promotes further production and release of epinephrine from the adrenal medulla. Therefore, the information provided from these studies, combined with the present data, supports the concept that the adrenergic neurons are responsible for the generation of high blood pressure, in the SHR, due to its control on the major site of epinephrine synthesis; the adrenal medulla. More importantly, these data imply that overexpression the PNMT gene in adrenergic neurons of the SHR contributes to elevated levels of circulating epinephrine and ultimately to the pathogenesis of hypertension.

Important stress-sensitive transcription factors that tightly regulate the PNMT gene promoter include Egr-1, AP-2, GR, and Sp1 (Ebert and Wong, 1995; Ebert et al., 1998; Tai et al., 2002; and Her et al., 2003). In the SHR, mRNA of transcriptional regulator Egr-1 was elevated in all adrenergic regions, but more drastically in the C2 adrenergic region. This confirms that the activation of the PNMT gene promoter in adrenergic neuron regions may be caused by altered transcriptional regulation and may therefore be a genetic mechanism responsible for the pathogenesis of hypertension. Egr-1 is known to also activate TH and therefore promotes overall catecholamine synthesis (Papanikolaou and Sabban, 2000; and Stephano et al., 2006). Furthermore, transcription factors GR, which regulates TH and PNMT, levels were downregulated in all three regions and is indicative of an overactive HPA axis (Ross et al., 1990; and Tai et al., 2002). Elevated levels of glucocorticoids are found in the SHR, which may be due to a dysregulation of glucocorticoid negative feedback mechanism or hyperactivation of the HPA axis caused by the adrenergic neurons (Petrov et al., 1993; Palkovits, 2002; and Kvetnansky et al., 2009). These data imply that increased levels of transcription factor Egr-1 may contribute to enhanced PNMT promoter activity and ultimately the pathogenesis of hypertension in the SHR model. This activation may be the initiation mechanism of excess glucocorticoid and epinephrine production experienced by the SHR.

Adrenergic neurons from all three regions send projections to the hypothalamus and therefore are able to activate the HPA axis and may therefore be responsible for the increased levels of glucocorticoids experienced by the SHR (Palkovits et al., 1980; Petrov et al., 1993; Palkovits, 2002; and Rinaman, 2007). Glucocorticoids subsequently activate the expression of TH and PNMT in the adrenal medulla, resulting in epinephrine production and elevations in blood pressure. Furthermore, adrenergic neurons from all three regions project directly to the adrenal medulla through the sympathoadrenal (SA) axis. From the splanchnic nerve, signalling cascades initiated by acetylcholine and pituitary adenylate cyclase-activating polypeptide (PACAP) control the expression of PNMT by regulating transcription factors Egr-1 and Sp1 (Morita and Wong, 1996; Tai and Wong, 2003; and Wong et al., 2008). Therefore, adrenergic neurons have an indirect (HPA axis) and a direct (SA) control on adrenal PNMT regulation.

Elevated blood pressure and reduced body weight were observed in the SHR rats of the current study and confirms the hypertensive phenotype in our animal model. These findings parallel those presented in literature (Pfeffer et al., 1982; Reja et al., 2002b; and Nguyen et al., 2009). SHR are known to have high sympathetic nerve activity (SNA) and experience insulin resistance and hypertriglyceridemia (Swislocki and Tsuzuki, 1993; Rubattu et al., 1993; and Ficková et al., 1997). Elevated SNA, specifically in adipose tissue, may be responsible for these metabolic abnormalities resulting in the reduced weight profile of the SHR (Cabassi et al., 2002). Furthermore, SHR have lower ATP to ADP ratios compared to WKY rats, due to increased cardiac workload and consequently a higher energy demand (Lakomkin et al., 2003). More energy-yielding molecules, such as glucose and triglycerides, are required however; this leads to the metabolic abnormalities, such as insulin resistance and hypertriglyceridemia, experienced by the SHR (Studneva et al., 1999).

In summary, the current study provides possible molecular mechanisms elucidating elevated production of PNMT mRNA in adrenergic neurons found in SHR rats. Elevated levels of Egr-1 mRNA are linked to increases in PNMT, leading to increased epinephrine synthesis and blood pressure. The findings presented propose that alterations in the PNMT gene regulation contribute to enhanced epinephrine synthesis that instigates hypertension in the genetic model of the SHR.